| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Genetics, Forestry and Agricultural Biotechnology Institute
(FABI), University of Pretoria, Pretoria, 0002, South Africa
2 Department of Microbiology and Plant Pathology, Forestry and Agricultural
Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South
Africa
3 Department of Microbiology, University of Stellenbosch, Private Bag X1,
Matieland, Stellenbosch, South Africa
*
Correspondence: Z. Wilhelm de Beer,
wilhelm.debeer{at}fabi.up.ac.za
 |
Abstract |
|---|
 TOP Abstract INTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
Taxonomic novelties: Ceratocystiopsis manitobensis (J. Reid & Hausner) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Cop. parva (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Cop. rollhanseniana (J. Reid, Eyjólfsd. & Hausner) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Grosmannia abiocarpa (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. aenigmatica (K. Jacobs, M.J. Wingf. & Yamaoka) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. americana (K. Jacobs & M.J. Wingf.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. aurea (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. cainii (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. clavigera (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. crassivaginata (H.D. Griffin) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. cucullata (H. Solheim) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. davidsonii (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. dryocoetidis (W.B. Kendr. & Molnar) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. europhioides (E.F. Wright & Cain) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. francke-grosmanniae (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. galeiformis (B.K. Bakshi) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. grandifoliae (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. huntii (R.C. Rob.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. laricis (K. van der Westh., Yamaoka & M.J. Wingf.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. leptographioides (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. olivacea (Math.-Käärik) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. pseudoeurophioides (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. radiaticola (J.-J. Kim, Seifert, & G.-H. Kim) Z.W. de Beer & M.J. Wingf. comb. nov., G. robusta (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. sagmatospora (E.F. Wright & Cain) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. vesca (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. wageneri (Goheen & F.W. Cobb) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov.
Keywords Ceratocystiopsis / Grosmannia / Ophiostoma / phylogenetics
|
INTRODUCTION |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
|
Teleomorph characters applied in taxonomic studies of Ophiostoma include the shape and size of the ascomata and ascospores, and the presence or absence of sheaths surrounding the ascospores. The majority of Ophiostoma spp. have ascomata with long necks giving rise to masses of sticky ascospores adapted for dispersal by insects (Upadhyay 1981, Harrington 1987, Jacobs & Wingfield 2001). In 1957, Parker described the genus Europhium A.K. Parker for a species that exhibits all the characters of Ophiostoma, but with ascocarps cleistothecial, lacking necks and ostioles (Parker 1957). Subsequently three additional species were described in Europhium (Robinson-Jeffrey & Davidson 1968). All four of the species were eventually transferred to Ophiostoma (Harrington 1987) because the formation or length of necks, and the presence of an ostiole, might be affected by the environment and were considered `less reliable' taxonomic characters (Upadhyay 1981). A number of phylogenetic studies confirmed that these species are closely related to Ophiostoma spp. with Leptographium anamorphs (Hausner et al. 2000, Lim et al. 2004).
Ophiostoma spp. have ascospores with unusual shapes. Several studies have applied this characteristic to define groups within the genus, which at the time of these studies was treated as a synonym of Ceratocystis (Wright & Cain 1961, Griffin 1968, Olchowecki & Reid 1973, Upadhyay 1981). For species that have falcate ascospores with sheaths and short perithecial necks, Upadhyay & Kendrick (1975) established Ceratocystiopsis H.P. Upadhyay & W.B. Kendr. However, Wingfield (1993) argued that ascospore shape should not be the sole character to delineate genera, and that it was illogical to maintain Ceratocystiopsis as a separate genus because Ophiostoma contained many species with a variety of other, distinct ascospore forms. He thus suggested that Ceratocystiopsis should be treated as a synonym of Ophiostoma and that ascospore morphology should only be one of several characteristics on which to base further subdivisions in the genus. Hausner et al. (1993a) proceeded to formally reduce Ceratocystiopsis to synonymy with Ophiostoma, based on partial SSU and LSU rDNA sequences. These authors included 10 Ceratocystiopsis spp., but only one Ophiostoma (O. ips (Rumbold) Nannf.) and one Ceratocystis (C. fimbriata Ellis & Halst.) species in the phylogenetic analysis of the data. Phylogenetic studies involving other ascomycete genera confirmed that ascospore morphology should not be used as the only character for taxonomic grouping as similar ascospore shapes often originated more than once in a genus (Hausner et al. 1992, Wingfield et al. 1994).
The diversity of the anamorphs associated with Ophiostoma established anamorph morphology as a preferred characteristic to group species in the genus (Münch 1907, Melin & Nannfeldt 1934, Hunt 1956, Davidson 1958, Mathiesen-Käärik 1960). However, this approach is complicated by the fact that a significant number of Ophiostoma spp. produce not only one, but combinations of up to three of the four possible anamorph states associated with the genus (De Hoog 1974, Okada et al. 1998). Ophiostoma ips, for example, has a continuum of synanamorph states, which based on current definitions range from Hyalorhinocladiella-like and Leptographium-like to Pesotum (Seifert et al. 1993). The anamorphs of just this one species have previously been classified in Graphium (Leach et al. 1934), Scopularia Preuss (Goidánich 1936), Cephalosporium auct. non Corda (Moreau 1952), Leptographium (Moreau 1952), Hyalorhinocladiella (Upadhyay 1981), Graphilbum H.P. Upadhyay & W.B. Kendr. (Upadhyay 1981), Acremonium Link: Fr. (Hutchison & Reid 1988), and Pesotum (Okada et al. 1998).
The only case where a teleomorph-genus has specifically been erected to accommodate Ophiostoma spp. based on a common anamorph, was when Goidánich (1936) established Grosmannia Goid. for four species with Leptographium anamorphs. He first described Grosmania invalidly, without a Latin description (Goidánich 1935). Later Goidánich validated the genus and at the same time corrected the spelling to Grosmannia (Goidánich 1936). Siemaszko (1939) reduced Grosmannia to synonymy with Ophiostoma on the basis of teleomorph morphology. Grosmannia has been treated in all subsequent studies as synonym of either Ophiostoma (Mathiesen 1951, Von Arx 1952, De Hoog 1974, Von Arx 1974, Seifert et al. 1993, Jacobs & Wingfield 2001) or Ceratocystis (Bakshi 1951, Moreau 1952, Hunt 1956, Davidson 1958, Griffin 1968, Upadhyay 1981). Phylogenetic studies have placed three of the original four Grosmannia species, G. serpens Goid., G. penicillata (Grosmann) Goid. and G. ips (Rumbold) Goid., in Ophiostoma (Hausner et al. 2000, Jacobs et al. 2001, Zhou et al. 2004a, 2005). The fourth species, G. pini (Münch) Goid., has been treated as a synonym of O. minus (Hedgc.) Syd. & P. Syd. (Moreau 1952, Hunt 1956, Griffin 1968, Olchowecki & Reid 1973, Upadhyay 1981) which, based on phylogeny, also resides in Ophiostoma (Gorton et al. 2004).
Amongst the four anamorph-genera associated with Ophiostoma spp., Sporothrix appears to be the most common form, with conidia produced sympodially on denticles arising from undifferentiated hyphae (De Hoog 1974). This is also the form that occurs most often as a synanamorph of Pesotum spp. (Crane & Schoknecht 1973, De Hoog 1974, Okada et al. 1998, Harrington et al. 2001). The original description of Pesotum included mononematous conidiophores and conidiogenous cells with prominent denticles, thus the Sporothrix-like component of the anamorph (Crane & Schoknecht 1973). In a study showing that Graphium is phylogenetically distinct from the synnematal anamorphs of Ophiostoma spp., and where Pesotum was redefined to encompass all synnematous anamorphs of Ophiostoma, only the synnematous form was described (Okada et al. 1998). The Sporothrix form was thus treated as a distinct synanamorph of Pesotum (Okada et al. 1998). However, Harrington et al. (2001) accepted the original description of Pesotum, which included the Sporothrix-like forms, but restricted the genus to anamorphs with affinities to the O. piceae complex. Harrington et al. (2001) also stated that the synnemata of Ophiostoma spp. outside the O. piceae complex are loose aggregates of Leptographium conidiophores, without the fused stipe cells that are characteristic of the O. piceae complex. These synnematous species outside the O. piceae complex often lack a Sporothrix anamorph, although some species produce a mononematous form without prominent denticles, resembling Hyalorhinocladiella. Hyalorhinocladiella was described for the mononematous anamorphs of Ceratocystiopsis and Ophiostoma (Upadhyay & Kendrick 1975), where conidia are produced through sympodial proliferation, leaving flat, ring-like scars on the surface of conidiogenous cells, as opposed to the denticles visible in Sporothrix spp. (Mouton et al. 1994, Benade et al. 1996). Although these anamorph-genera can be defined broadly, the delimitation of species groups based on anamorph morphology remains problematic, especially because of intermediate and overlapping forms.
Phylogenetic studies have substantially improved the ability to delimit species within almost all the morphological groups (based on ascospores and anamorphs) of the genus Ophiostoma (Harrington et al. 2001, De Beer et al. 2003, Jacobs & Kirisits 2003, Kim et al. 2003, Gorton et al. 2004, Lim et al. 2004, Zhou et al. 2004b). In the more recent of these studies, multigene approaches employing ribosomal together with protein-coding genetic data have become the norm. The morphological divergence in Ophiostoma strongly suggests that some of the morphological traits must be represented by monophyletic lineages. However, phylogenetic studies that have all been based on partial ribosomal DNA data have failed to support the definition of monophyletic lineages in Ophiostoma (Hausner et al. 1993b, 2000, Jacobs et al. 2001, Hausner & Reid 2003). In this investigation we reconsider the view that Ophiostoma might be logically subdivided based on monophyly. This is achieved using DNA sequences from domains 1 and 2 of the 5' end of the nuclear LSU gene, together with partial sequences for the β-tubulin gene region. Fifty species of Ophiostoma representing all the ascospore forms and anamorph shapes associated with the genus are included in the study.
|
MATERIALS AND METHODS |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
|
A large variety of potential outgroups were initially tested for suitability in the phylogenetic analysis used in this study. From these tests three species of Cryphonectria were selected as being the most appropriate and these include: Cry. cubensis (CBS 101281; LSU = AF408338 [GenBank] ; β-tubulin = DQ246580 [GenBank] ), Cry. havanensis (CBS 505.63; LSU = AF408339 [GenBank] ; β-tubulin = AY063478 [GenBank] ), and Cry. nitschkei (CBS 109776; LSU = AF408341 [GenBank] ; β-tubulin = DQ120768 [GenBank] ). The names used here are those published by Castlebury et al. (2002) in GenBank although we recognize that Gryzenhout et al. (2005) have shown that Cry. havanensis (CBS 505.63) is incorrectly identified and also represents Cry. cubensis.
DNA extraction and PCR
DNA was extracted from mycelium grown on 2 % MEA using the DNA extraction
method described by Aghayeva et al.
(2004). Two genes were
amplified for sequencing and phylogenetic analysis. The 5' end of the nuclear
large subunit rDNA was amplified using the primers LR0R (5' ACCCGCTGAACTTAAGC
3') and LR5 (5' TCCTGAGGGAAACTTCG 3')
(http://www.biology.duke.edu/fungi/mycolab/primers.htm).
Part of the β-tubulin gene was amplified with primers T10 (5'
ACGATAGGTTCACCTCCAGAGAC 3') (O'Donnell
& Cigelnik 1997) or Bt2a (5' GGTAACCAAATCGGTGC GCTTTC 3') in
combination with Bt2b (5' GGTAACCAAATCGGTGCTGCTTTC 3')
(Glass & Donaldson 1995).
Reaction volumes for the PCR amplification were 50 µL and contained 5 µL
10 x PCR reaction buffer (Super-Therm, JMR Holdings, U.S.A.), 2.5 mM
MgCl2, 10 mM dNTP, 10 µM of each primer, 2 µL DNA and 2.5 U
Super-Therm Taq polymerase (JMR Holdings, U.S.A.). The PCR conditions for the
amplification of both the LSU and β-tubulin genes included denaturing for
3 min at 94 °C, annealing at 47–52 °C for 1 min, and elongation
at 72 °C for 1 min. This was repeated for 35 cycles ending with a final
elongation step at 72 °C for 5 min. Success of the PCR amplification was
confirmed on a 1 % (w/v) agarose gel stained with ethidium bromide. DNA was
visualized under UV light. The PCR fragments were purified with QIAquick®
PCR purification kit (Quiagen®) eluting the DNA in water.
DNA sequencing
Sequencing of the purified PCR fragments was performed using the primers
noted above and the Big DyeTM Terminator v. 3.0 cycle sequencing premix
kit (Applied Biosystems, Foster City, CA, U.S.A.). The fragments were analyzed
on an ABI PRISIMTM 377 or ABI PRISIMTM 3100 Genetic Analyzer
(Applied Biosystems). DNA Sequence data were edited using Sequence Navigator
(Applied Biosystems) and aligned in CLUSTAL-X
(Thompson et al.
1997) and then in T-Coffee
(Notredame et al.
2000) using multiple alignment algorithms. T-Coffee was used to
combine the alignment results of Clustal X with the local and global pairwise
alignments obtained in T-Coffee, to produce a multiple sequence alignment with
the best agreement of these methods. The default parameters in T-Coffee were
used for the analysis. Manual adjustments of the dataset were performed in
PAUP v. 4.0b8 (Phylogenetic Analysis Using Parsimony)
(Swofford 2001) as follows:
for the analysis of the partial LSU gene, sequences were trimmed at the 5' and
3' ends to align with DNA sequences from GenBank used for the outgroups. For
the partial β-tubulin gene the sequences were trimmed on the 5' end to
correspond with the beginning of exon 4 of the β-tubulin gene. Analyses
were carried out using parsimony, neighbour-joining and maximum likelihood
(Swofford 2001) and Bayesian
inference (MrBayes 3.0b4) (Huelsenbeck
& Ronquist 2001).
Phylogenetic analysis
Maximum parsimony: For parsimony analysis, ambiguous and missing
nucleotides were eliminated and the remaining characters were weighted
according to the consistency index (CI). A heuristic search was performed with
tree-bisection-reconnection (TBR) branch swapping. The resulting trees were
used to obtain a majority rule consensus tree. Confidence values were
estimated using Bootstrap analysis (1000 replicates) with the full consensus
option.
Bayesian inference: Data were analysed using a Bayesian approach based on a Markov chain Monte Carlo (MCMC) analysis. A general time reversal (GTR+I+G) model as determined by AIC criteria of Modeltest (Posada & Crandall 1998) was used for the analysis. The proportion of sites was assumed to be invariable, while the rate of the remaining sites was drawn from a gamma distribution with six categories. All parameters were inferred from the data. Four Markov chains were initiated at random and the program was allowed to run for 2000000 generations with a sample frequency of 100. The analysis was repeated six times and consensus trees obtained from the six independent analyses were examined for consistency. One of the six analyses was used to calculate a consensus tree with mean branch lengths. The likelihood convergence was determined and these sampled trees were discarded as burn in. The following trees with their branch lengths were used to generate a consensus tree based on 50 % majority rule with mean branch lengths and posterior probabilities for the nodes using PAUP (Swofford 2001).
Neighbour-joining: A distance tree was calculated using Neighbour-joining analysis based on the evolutionary model that was determined as GTR+I+G based on AIC criteria using the Modeltest 3.06 (Posada & Crandall 1998). Distance settings were adjusted according to the Akaike information criteria (AIC) model: proportion invariable sites were assumed to be 0.4369 and the rates for variable sites were assumed to follow a gamma distribution with shape parameter of 0.5593. Confidence was determined by 1000 bootstrap replicates. The starting tree was obtained from the Neighbour-joining tree, the branch swap algorithm set to TBR (tree bisection reconnection).
Maximum likelihood: Likelihood settings were set according to GTR+I+G model as determined by AIC criteria in Modeltest 3.06 (Posada & Crandall 1998). Assumed proportion invariable sites were set to 0.4369. The variable sites were assumed to have a gamma distribution with a 0.5593 shape parameter. The search was performed heuristically with random stepwise addition and TBR branch swapping. Confidence values were estimated using bootstrap analysis (1000 replicates) determined by heuristic search and TBR branch swapping.
|
RESULTS |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
|
Phylogenetic analysis
Preliminary cladistic analysis based on parsimony showed that trees
generated for both LSU (data not shown) and combined LSU/β-tubulin gene
regions had similar topologies. Furthermore, the combined data set resulted in
higher confidence values for the obtained groupings. Combined LSU and
β-tubulin data sets (excluding β-tubulin introns), which consisted
of a total of 934 characters, were thus used. Congruence of the LSU and
β-tubulin datasets was not supported by the partition homogeneity test
(PHT). This was most probably due to the highly conserved nature of the
β-tubulin gene resulting in poor resolution of the terminal branches. The
similar node topology of the trees obtained from the LSU and
LSU/β-tubulin genes, and the increased bootstrap support for the groups
obtained using the combined data set, justified that the data of these two
genes should be considered together, irrespective of the incongruence of the
loci.
Maximum parsimony: For the cladistic analysis of the combined data set, 39 missing and ambiguous characters were excluded from the analysis. Of the remaining 895 characters, 608 characters were constant, 48 variable characters were parsimony-uninformative and 239 characters were parsimony-informative. Characters were re-weighted according to the maximum consistency index. This resulted in 751 characters with a weight of 1, and 144 characters with a weight other than 1. Four trees with similar topologies were obtained using maximum parsimony analysis with the tree bisection reconnection (TBR) branch swapping algorithm. The deeper nodes were consistent in all four trees, with slight variations in the topology of the terminal nodes. From the four trees a 50 % majority rule consensus tree was compiled with the TBR algorithm. The tree length was 383 steps, CI = 0.656, and the retention index (RI) = 0.860. A consensus cladogram was obtained (Fig. 1).
The cladogram (Fig. 1) showed that the taxa are grouped in distinct, well-supported clades. Clade A (91 % bootstrap) included only taxa that have Leptographuim anamorph states. All the species in this group had intron 4 and lacked intron 5 in the β-tubulin gene (Fig. 1). Clade B (82 % bootstrap) consisted of several distinct groups. Within Clade B, Clade C (100 % bootstrap) formed a monophyletic group including the recently described species O. rollhansenianum J. Reid, Eyjólfsd. & Hausner and O. manitobense J. Reid & Hausner, as well as taxa previously residing in the genus Ceratocystiopsis. These taxa all have short perithecial necks and falcate ascospores, and are sensitive to cycloheximide. Two anamorph states are associated with taxa in this group. They are Sporothrix, the anamorph of O. ranaculosum (J.R. Bridges & T.J. Perry) Hausner, J. Reid & Klassen, and Hyalorhinocladiella, associated with O. minuta-bicolor (R.W. Davidson) Hausner, J. Reid & Klassen, O. minutum Siemaszko, O. minimum (Olchowecki & J. Reid) Hausner, J. Reid & Klassen, O. rollhansenianum and O. manitobense.
|
Clade H (76 % bootstrap) consisted only of taxa with Sporothrix anamorphs and ascospores varying from orange section to allantoid in shape. The species in this clade all lacked intron 4 and had intron 5 in the β-tubulin gene (Fig. 1). In this clade, O. nigrocarpum (R.W. Davidson) de Hoog grouped separately from the other taxa that formed a clade with 98 % bootstrap support. Species in this clade include Sporothrix schenckii Hektoen & C.F. Perkins, the type species for the anamorph-genus Sporothrix, O. stenoceras (Robak) Nannf., S. inflata de Hoog, O. fusiforme D.N. Aghayeva & M.J. Wingf. and O. lunatum D.N. Aghayeva & M.J. Wingf. The three species of Ophiostoma found within infructescences of Protea spp. in South Africa, O. splendens G.J. Marias & M.J. Wingf., O. protearum G.J. Marias & M.J. Wingf., and O. africanum G.J. Marias & M.J. Wingf., constituted a well-defined, smaller clade with strong bootstrap support within Clade H.
Bayesian inference: Consistent results were obtained in the six runs of the Bayesian phylogenetic analysis (Model GTR+I+G). The topologies of the obtained trees differed only slightly in the terminal nodes where low confidence values were obtained. No variations were observed in the deeper nodes supported by high confidence values. The stationary phase of the Markov chains was observed after 33000 generations. The first 2000 trees (representing 200000 generations) were thus discarded and 18000 trees were included to calculate the 50 % rule consensus tree for each run. One of the phylogenetic trees obtained is presented in Fig. 2. The calculated confidence values (posterior probabilities) are indicated above the relevant nodes where support exceeded 50 %.
The deeper nodes obtained from the Bayesian analysis (MB) were identical to those obtained with maximum parsimony (MP). Support for the groups was, however, higher for Bayesian inference in the deeper branches than the Bootstrap support obtained for MP: group A (MB = 99 %; MP = 91 %), group B (MB = 86 %; MP = 82 %), group C (MB = 100 %; MP = 100 %), group D (MB = 100 %; MP = 66 %). Group D consisted of several subgroups. Groups E (MB = 100 %; MP = 100 %), H (MB = 98 %; MP = 76 %), and J (MB = 100 %; MP = 98 %) remain clustered together with high statistical support. However, the topology of the groups found within group D, obtained from Bayesian inference, differ in structure from the topology obtained in MP analysis. One major difference in topology is that group E forms as a separate group basal to group H and G in the MP analysis, while Bayesian inference resulted in group E forming part of group G. However, group E remained a separate entity with high posterior probability support.
Neighbour-joining: Phylogenetic distance was determined by Neighbour-joining (NJ) analyses based on the general time reversal model. Statistical support for the nodes was calculated using 1000 NJ bootstrap repeats. NJ support values for nodes obtained are indicated bold (Fig. 2). The topology obtained from NJ is similar to that obtained from Bayesian inference. With the exception of group E, clustering basal to group J and I closest to group G and not basal to groupings G and H or within group F as observed on MP and Bayesian analysis respectively.
Maximum likelihood: For the phylogenetic relationship estimated using maximum likelihood (ML), the GTR+I+G evolutionary model determined by Model Test based on Akaike Information Criteria (AIC) was applied. Estimated proportion invariable sites (I) was set to 0.4369 and the shape parameter for gamma distribution (G) was set to 0.5595 and no molecular clock was enforced on the data set. Bootstrap values for the groupings were determined by 1000 bootstrap repeats. ML support (50 % or higher) for groups obtained are indicated in italics (Fig. 2) on the phylogenetic tree obtained by Bayesian inference. Groups A–C, E, and H–J were supported by ML. However the deeper node resolution of these groups differs significantly from MP and Bayesian inference. Groupings D and G were not supported and group B had poor ML statistical support.
For consistency in the discussion we refer to the clades obtained in parsimony analysis, and the groups obtained in Bayesian, NJ and ML analysis, as groups.
|
TAXONOMY |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
Ophiostoma Syd. & P. Syd., Ann. Mycol. 17: 43. 1919. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascocarps subhyaline to dark brown to black, bases globose; necks straight or flexuous, cylindrical, brown to black; ostiole often surrounded by ostiolar hyphae. Asci 8-spored, evanescent, globose to broadly clavate. Ascospores hyaline, aseptate, cylindrical, lunate, allantoid, reniform, orange section- or pillow-shaped, sometimes with a hyaline, gelatinous sheath. Anamorphs most commonly Sporothrix and/or Pesotum, occasionaly Hyalorhinocladiella-like, rarely Leptographium-like. Phylogenetically classified in the Ophiostomatales.
Type species: Ophiostoma piliferum Fr.: Fr. Syd. & P. Syd., Ann. Mycol. 17: 43. 1919.
Basionym: Sphaeria pilifera Fr., Syst Mycol. 2: 472. 1822.
Ceratostoma piliferum (Fr.) Fuckel, Symb. Mycol. p. 128.
1869. Ceratostomella pilifera (Fr.) G. Winter, Rabenh.
Kryptogamen-Flora 1: 252. 1887. Linostoma piliferum (Fr.) Höhn., Ann. Mycol. 16: 91.
1918. Ceratocystis pilifera (Fr.) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Anamorph: Sporothrix (De Hoog 1974).
Ceratocystiopsis H.P. Upadhyay & W.B. Kendr., Mycologia 67: 799. 1975. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascocarps subhyaline to dark brown to black, bases globose to subglobose; necks relatively short, mostly tapered toward the apex, sometimes surrounded by a collar-like structure; ostiolar hyphae convergent or lacking. Asci 8-spored, evanescent, fusiform, clavate or ellipsoidal, hyaline. Ascospores hyaline, aseptate, elongate, falcate, or slender with obtuse ends, sometimes with bulbous swelling, most often with a hyaline sheath. Sensitive to cycloheximide. Anamorphs Hyalorhinocladiella or Sporothrix-like. Phylogenetically classified in the Ophiostomatales within a monopyletic lineage including Ceratocystiopsis minuta.
Ceratostomella minuta (Siemaszko) R.W. Davidson, Mycologia
34: 655. 1942. Ceratocystis minuta (Siemaszko) J. Hunt, Lloydia 19: 49.
1956. Ophiostoma concentricum (Olchow. & J. Reid) Hausner
& J. Reid, Canad. J. Bot. 81: 874. 2003. Ophiostoma minimum (Olchow. & J. Reid) Hausner, J.
Reid & Klassen, Mycol. Res. 97: 631. 1993. Ophiostoma minutum-bicolor (R.W. Davidson) Hausner, J.
Reid & Klassen, Mycol. Res. 97: 631. 1993. Ophiostoma pallidobrunneum (Olchow. & J. Reid) Hausner
& J. Reid, Canad. J. Bot. 81: 875. 2003. Ophiostoma parvum (Olchow. & J. Reid) Hausner, J. Reid
& Klassen, Mycol. Res. 97: 631. 1993. Ophiostoma ranaculosum (J.R. Bridges & T.J. Perry)
Hausner, J. Reid & Klassen, Mycol. Res. 97: 631. 1993.
Status of other species linked to Ceratocystiopsis
Ceratocystiopsis crenulata (Olchow. & J. Reid) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 124. 1981. Ceratocystiopsis falcata (E.F. Wright & Cain) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 125. 1981. Ceratocystiopsis longispora (Olchow. & J. Reid) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 128. 1981. Ceratocystiopsis retusi (R.W. Davidson & T.E. Hinds)
H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 135. 1981. Grosmannia Goid., Boll. Staz. Patol. Veg. 16: 27. 1936. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascomata black, bases globose, seldom ornamented; necks absent or present, pigmented, tapered toward apex; ostiolar hyphae mostly absent, when present, convergent or divergent. Asci 8-spored, evanescent. Ascospores hyaline, aseptate, reniform, curved, allantoid, fusiform, orange section- or hat-shaped, often invested in a sheath. Anamorph Leptographium, or with synnemata appearing as a loose aggregation of Leptographium conidiophores. Phylogenetically classified in the Ophiostomatales within a monophyletic group containing Grosmannia penicillata. β-tubulin gene contains intron 4 and lacks intron 5.
Ophiostoma penicillatum (Grosmann) Siemaszko, Planta Pol.
7: 24. 1939. Ceratocystis penicillata (Grosmann) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Scopularia penicillata (Grosmann) Goid., Boll. Staz.
Patol. Veg. 16: 39. 1936. Verticicladiella penicillata (Grosmann) W.B. Kendr.,
Canad. J. Bot. 40: 776. 1962. Ophiostoma abiocarpum (R.W. Davidson) T.C. Harr.,
Mycotaxon 28: 41. 1987. Ceratocystis aurea (R.C. Rob.-Jeffr. & R.W. Davidson)
H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 37. 1981. Ophiostoma aureum (R.C. Rob.-Jeffr. & R.W. Davidson)
T.C. Harr., Mycotaxon 28: 41. 1987. Ophiostoma cainii (Olchow. & J. Reid) T.C. Harr.,
Mycotaxon 28: 41. 1987. Ceratocystis clavigera (R.C. Rob.-Jeffr. & R.W.
Davidson) H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 40. 1981. Ophiostoma clavigerum (R.C. Rob.-Jeffr. & R.W.
Davidson) T.C. Harr., Mycotaxon 28: 41. 1987. Graphiocladiella clavigera H.P. Upadhyay, In Upadhyay,
Monograph of Ceratocystis and Ceratocystiopsis: 40. 1981. Pesotum clavigerum (H.P. Upadhyay) G. Okada & Seifert,
Canad. J. Bot. 76: 1503. 1998. Ceratocystiopsis crassivaginata (H.D. Griffin) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 123. 1981. Ophiostoma crassivaginatum (H.D. Griffin) T.C. Harr.,
Mycotaxon 28: 41. 1987. Ophiostoma davidsonii (Olchow. & J. Reid) H. Solheim,
Nordic J. Bot. 6: 203. 1986. Ophiostoma dryocoetidis (W.B. Kendr. & Molnar) de Hoog
& R.J. Scheff., Mycologia 76: 297. 1984. Verticicladiella dryocoetidis W.B. Kendr. & Molnar,
Canad. J. Bot. 43: 39. 1965. Ophiostoma europhioides (E.F. Wright & Cain) H.
Solheim, Nordic J. Bot. 6: 203. 1986. Ophiostoma francke-grosmanniae (R.W. Davidson) de Hoog
& R.J. Scheff., Mycologia 76: 297. 1984. Ophiostoma galeiforme (B.K. Bakshi)
Math.-Käärik, Medd. Skogsforskninginst. 43: 47. 1953. Ophiostoma grandifoliae (R.W. Davidson) T.C. Harr.,
Mycotaxon 28: 41. 1987. Ophiostoma huntii (R.C. Rob.-Jeffr.) de Hoog & R.J.
Scheff., Mycologia 76: 297. 1984. Ophiostoma leptographioides (R.W. Davidson) Arx, Antonie
van Leeuwenhoek 18: 211. 1952. Ceratocystis leptographioides (R.W. Davidson) J. Hunt,
Lloydia 19: 28. 1956. Ceratocystis olivacea (Mathiesen) J. Hunt, Lloydia 19: 29.
1956. Ophiostoma piceiperdum (Rumbold) Arx, Antonie van
Leeuwenhoek 18: 211. 1952. Ceratocystis piceiperdum (Rumbold) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Ophiostoma pseudoeurophioides (Olchow. & J. Reid)
Hausner, J. Reid & Klassen, Canad. J. Bot. 71: 1264. 1993. Hyalopesotum pini L.J. Hutchison & J. Reid, N.Z. J.
Bot. 26: 90. 1988. Ceratocystis robusta (R.C. Rob.-Jeffr. & R.W.
Davidson) H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 58. 1981. Ophiostoma robustum (R.C. Rob.-Jeffr. & R.W. Davidson)
T.C. Harr., Mycotaxon 28: 42. 1987. Ophiostoma sagmatosporum (E.F. Wright & Cain) H.
Solheim, Nordic J. Bot. 6: 203. 1986. Phialographium sagmatosporae H.P. Upadhyay & W.B.
Kendr., Mycologia 66: 183. 1974. Graphium sagmatosporae (H.P. Upadhyay & W.B. Kendr.)
M.J. Wingf. & W.B. Kendr., Mycol. Res. 95: 1332. 1991. Ophiostoma serpens (Goid.) Arx, Antonie van Leeuwenhoek
18: 211. 1952. Ceratocystis serpens (Goid.) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Scopularia serpens Goid., Boll. Staz. Patol. Veg. 16: 42.
1936. Verticicladiella serpens (Goid.) W.B. Kendr., Canad. J.
Bot. 40: 781. 1962. Leptographium alacre (M.J. Wingf. & Marasas) M.
Morelet, Ann. Soc. Sci. Nat. Archéol. Toulon Var 40: 44. 1988. Ophiostoma vescum (R.W. Davidson) Hausner, J. Reid &
Klassen. Can J. Bot. 71: 1264. 1993. Ophiostoma wageneri (Goheen & F.W. Cobb) T.C. Harr.,
Mycotaxon 28: 42. 1987. Verticicladiella wageneri var. ponderosae T.C.
Harr. & F.W. Cobb, Mycol. 78: 568. 1986.
Status of other species linked to Leptographium
Ceratocystis imperfecta (V. V. Miller & Tcherntz.) C.
Moreau, Rev. Mycol. (Paris), Suppl. Colon. 17: 22. 1952. Ophiostoma obscurum (R.W. Davidson) Arx, Antonie van
Leeuwenhoek 18: 211. 1952. (superfluous combination). Ceratocystis obscura (R.W. Davidson) J. Hunt, Lloydia 19:
30. 1956. Grosmannia pini (Münch) Goid., Boll. Staz. Patol.
Veg. 16: 27. 1936. Ceratocystis pini (Münch) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Ceratocystis rostrocylindrica (R.W. Davidson) J. Hunt,
Lloydia 19: 26. 1956. Ceratocystis trinacriformis (A.K. Parker) H.P. Upadhyay,
In Upadhyay, Monograph of Ceratocystis and Ceratocystiopsis: 63.
1981. Ceratocystis truncicola (R.W. Davidson) H.D. Griffin,
Canad. J. Bot. 46: 710. 1968. Ophiostoma valdivianum (Butin) T.C. Harr., Mycotaxon 28:
42. 1987 (superfluous combination). |
DISCUSSION |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
The genus Ceratocystiopsis has been re-instated to accommodate taxa that have short ascomatal necks, produce falcate ascospores with sheaths and have Hyalorhinocladiella (occasionally Sporothrix-like) anamorphs. Upadhyay & Kendrick (1975) established Ceratocystiopsis to separate taxa having these distinct characteristics from taxa residing in the aggregate genus Ceratocystis. Our data revealed a strongly supported, monophyletic lineage with Cop. minuta central to it, and with morphological characters consistent with the original description of Ceratocystiopsis. All species in this group have β-tubulin intron 4 and lack intron 5. This monophyletic group was previously recognised and described as the Minuta complex by Hausner et al. (2003), and the nine species in the complex were characterised by sensitivity to cycloheximide. Amalgamating the data from this study and other published phylogenetic data, Ceratocystiopsis accommodates 11 species.
Hausner et al. (2003) retained their earlier view (Hausner et al. 1993a) that the group treated as Ceratocystiopsis in this study, could not constitute a genus because some species with falcate ascospores did not form part of this lineage. The view here would be that falcate ascospores evolved more than once in the Ophiostomatales. Amongst the species not monophyletic with Cop. minuta, two (Cop. alba, Cornuvesica falcata) are completely unrelated to the Ophiostomatales, no phylogenetic data exist for three species (Cop. conicicollis, Cop. ochracea, Cop. spinulosa), and one has a Leptographium anamorph and resides in Grosmannia (G. crassivaginata). The remaining five species (O. carpenteri, O. crenulatum, O. fasciatum, O. longisporum, O. retusum) are all more closely related to Ophiostoma spp. than to Cop. minuta, and we treat these as species of Ophiostoma. Results of the present study have shown that there is substantial, consistent phylogenetic evidence to support a distinct generic taxon for Ceratocystiopsis.
Grosmannia has been reinstated to accommodate teleomorph taxa that form a monophyletic group including both G. penicillata (type species of Grosmannia) and Leptographium lundbergii (type species of Leptographium). Species in this genus are also characterized by the presence of intron 4 and absence of intron 5 in the β-tubulin gene. Goidánich (1936) established Grosmannia for four species with Scopularia (= Leptographium) anamorphs. However, the genus was not widely recognised and most teleomorph species with Leptographium anamorphs were treated as Ceratostomella, Ceratocystis, Europhium, and more recently, Ophiostoma (Table 1).
Hausner et al. (2000) indicated that Ophiostoma spp. with Leptographium anamorphs appear to group together. However, they interpreted the separation of these species from other Ophiostoma spp. that are related to the type of the genus, O. piliferum, as artificial. Their conclusions were based on sequences of the partial ribosomal SSU and LSU regions. Results of the present study arose from the 5' region of the nuclear LSU gene, including the variable D1 and D2 regions, and partial DNA sequence data for β-tubulin, a coding gene. These regions are more variable than those used by Hausner et al. (2000). We thus found consistently strong support for the group of species that incorporates G. penicillata and L. lundbergii, as well as 13 other species with Leptographium anamorphs.
Nine of the species that we have accommodated in Grosmannia produce synnematous synanamorphs together with a Leptographium state, or a continuum of forms between the two states. The synnematous anamorphs of seven of the nine species (G. cainii, G. clavigera, G. cucullata, G. davidsonii, G. olivacea, G. sagmatospora, G. vesca) were assigned to the genus Pesotum by Okada et al. (1998), applying their inclusive definition of Pesotum. The anamorphic fungus, Pesotum pini, was also included in their list of new combinations (Okada et al. 1998). The teleomorph for this species, G. radiaticola, was discovered only recently (Kim et al. 2005) and represents one of the nine species that we have assigned to Grosmannia. The other Grosmannia species that forms a synnematous anamorph is G. galeiformis. This species was not included in the study of Okada et al. (1998). Zhou et al. (2004b) recognized that the synnematous anamorph of G. galeiformis dominates in culture, but accepted the suggestion of Harrington et al. (2001) to retain Pesotum for anamorphs of the O. piceae complex. Zhou et al. (2004), therefore, recommended that the Leptographium state be treated as the primary anamorph of O. galeiforme.
Harrington et al. (2001) suggested that synnemata evolved more than once in Ophiostoma (sensu Harrington, including Grosmannia). They suggested that synnemata with fused stipe cells and a Sporothrix synanamorph were only formed by species in the O. piceae complex. The synnemata of the nine Grosmannia spp. with synnematous anamorphs treated in this study, are best viewed as a `loose aggregation of Leptographium conidiophores' (Harrington et al. 2001). Furthermore, none of the nine species have micronematous conidiophores such as those defining Sporothrix (Harrington et al. 2001). Upadhyay (1981) described Graphiocladiella Upadhyay, with the anamorph of G. clavigera as type species, for species with both mononematous (Leptographium-like) and synnematous anamorphs. This could then be the appropriate genus in which to accommodate the anamorphs of Grosmannia spp. exhibiting both conidiophore types, and anamorph species producing synnematous anamorphs that phylogenetically reside in Grosmannia.
The only Grosmannia species that has been reported to produce a Sporothrix synanamorph together with a Leptographium state, is G. francke-grosmanniae (Mouton et al. 1992). However, the Sporothrix state was not mentioned in the descriptions of the species by Upadhyay (1981) and Jacobs & Wingfield (2001), possibly indicating that this form is produced only rarely. Two Leptographium spp. without known teleomorphs, L. elegans M.J. Wingf., Crous & Tzean, and L. bistatum J.-J. Kim & G.-H. Kim, also produce Sporothrix-like synanamorphs (Jacobs & Wingfield 2001, Kim et al. 2004). Illustrations of L. elegans (Jacobs & Wingfield 2001) and L. bistatum (Kim et al. 2004) shows that conidiophores bearing denticulate conidiogenous cells, become pigmented towards the base. This is in contrast with species of Sporothrix s. str. (with S. schenckii as type), defined as having hyaline conidiophores (De Hoog 1974). Both these Leptographium spp. have been shown to be phylogenetically related to the fungi that we now treat in Grosmannia (Jacobs et al. 2001, Kim et al. 2004), but they do not consistently group in a monophyletic clade with each other or with G. francke-grosmanniae (Kim et al. 2004). Even though some Grosmannia and/or Leptographium spp. might produce Sporothrix-like conidiophores, it is our view that this character is rare and inconsistent with the definition of Sporothrix s. str.
The Ophiostoma spp. included in the present study formed a monophyletic group (Group D in Figs 1, 2) that consisted of a number of strongly supported subgroups. Group J was supported consistently with high bootstrap values and included O. ips, O. montium and O. pulvinisporum. These species all have pillow-shaped ascospores with distinct sheaths that distinguish them from all other species in Ophiostoma (Rumbold 1936, Olchowecki & Reid 1973, Zhou et al. 2004a). All three species exhibit a continuum of anamorph structures described as Hyalorhinocladiella, Leptographium- and Pesotum-like (Table 2). Our data distinctly separate these taxa from species in Grosmannia with Leptographium anamorphs. Harrington et al. (2001) also argued that the synnematous anamorph of O. ips should not be referred to as Pesotum, since O. ips does not have a Sporothrix synanamorph, which is also true for the other two species. The notion of De Hoog (1993) that only Ophiostoma spp. with pillow-shaped or falcate ascospores (thus Ceratocystiopsis spp.) have Hyalorhinocladiella anamorphs, is supported by our data.
Another group of Ophiostoma spp. with relatively high bootstrap support (Group I) included the type species for the genus, O. piliferum, together with O. distortum and O. flexuosum that have Sporothrix anamorphs (Seifert et al. 1993). The group also includes O. ainoae and O. araucariae that have Pesotum-like anamorphs but no recorded Sporothrix synanamorphs (Harrington et al. 2001). The remaining taxa in Group I are members of the O. piceae complex (sensu Harrington et al. 2001) that have Pesotum anamorphs. The group thus represents species spanning the entire spectrum of the anamorph continuum; those that have only a Sporothrix anamorph, those with anamorphs in Pesotum sensu Harrington et al. (2001) (synnematal structures as well as Sporothrix states), and those that have synnemata lacking the Sporothrix state. All the species residing in Group I have ascospores without sheaths that vary from cylindrical to orange section-shaped. All the species in this group also have intron 4 and lack intron 5 in the β-tubulin gene (Fig. 1). Harrington et al. (2001) defined the O. piceae complex as a well-resolved monophyletic group containing nine species with Pesotum anamorphs. However, our results show that other species without Pesotum anamorphs group in between species of the so-called complex. Resolution in our data is poor, most probably because of the conserved nature of the genes in our analyses. ITS and β-tubulin sequence data including the introns, will be necessary to resolve the phylogeny of the species in this group.
A subgroup (Group E) of the Ophiostoma group (D), with consistently high statistical support includes O. pluriannulatum, O. multiannulatum, O. subannulatum, and O. carpenteri. The first three species have long ascomatal necks with annuli and reniform ascospores without sheaths (Hedgcock 1906, Davidson 1935, Livingston & Davidson 1987). Ophiostoma carpenteri has a relatively short perithecial neck with no annuli and elongated clavate ascospores without sheath (Hausner et al. 2003). All four species have prominent ostiolar hyphae and Sporothrix anamorphs producing secondary conidia (Hedgcock 1906, Davidson 1935, Livingston & Davidson 1987).
Group H in the Ophiostoma group (D) consists of species that have only Sporothrix anamorphs. This group included Sporothrix schenckii, the type species of the genus. All species in the group lack intron 4 and have intron 5 of the β-tubulin gene (Fig. 1). Where teleomorphs are known, ascospores are more or less reniform and not protected by a sheath (Table 2). The taxa in this group are found in a diverse range of ecological niches. For example: S. schenckii occurs on wood and in soil, and causes human sporotrichosis (De Hoog 1993, De Beer et al. 2003), S. inflata occurs in soil (De Hoog 1974), and O. nigrocarpum, O. stenoceras, O. fusiforme and O. lunatum are wood-inhabiting (Robak 1932, Davidson 1966, Aghayeva et al. 2004). Three species, O. splendens, O. protearum and O. africanum have been reported only from Protea infructescences in South Africa (Marais & Wingfield 2001). Our data suggest that the species from Protea might form a monophyletic lineage within Ophiostoma. However, this hypothesis was not supported where greater numbers of species from proteas were included (Roets et al. 2006).
Data derived from this study provide strong support for the separation of Grosmannia and Ceratocystiopsis from Ophiostoma. This separation has been implemented and it will hopefully simplify the application of names for the large number of species occurring in Ophiostoma sensu lato. Although our definition of Ophiostoma sensu stricto treats this genus as if it is a unified group of species, our data provide relatively strong support for the view that it contains a number of groups, supported by morphological and possibly ecological characters. At the present time we believe that there is insufficient data to further subdivide Ophiostoma in a meaningful way. However, we are convinced that addition of taxa and consideration of DNA sequence data for additional gene regions will result in the emergence of further genera in Ophiostoma sensu lato.
|
Acknowledgments |
|---|
|
References |
|---|
|
TOPAbstractINTRODUCTIONMATERIALS AND METHODSRESULTSTAXONOMYDISCUSSIONReferences |
|---|
Aghayeva DN, Wingfield MJ, De Beer ZW, Kirisits T
(2004). Two new Ophiostoma species with
Sporothrix anamorphs from Austria and Azerbaijan.
Mycologia 96:866
–878.
Bakshi BK (1951). Studies on four species of Ceratocystis, with a discussion on fungi causing sap-stain in Britain. Mycological Papers 35:1 –16.
Benade E, Wingfield MJ, Van Wyk PS (1996). Conidium development in the Hyalorhinocladiella anamorph of Ceratocystiopsis minuta-bicolor and Ophiostoma minus.Canadian Journal of Botany 74:891 –897.
Benade E, Wingfield MJ, Van Wyk PS (1998). Conidium development in Hyalodendron and Allescheriella anamorphs of Ophiostoma and Ceratocystiopsis. Mycotaxon 68:251 –263.
Brasier CM (1991). Ophiostoma novo-ulmi sp. nov., causative agent of current Dutch elm disease pandemics. Mycopathologia 115:151 –161.[CrossRef][Web of Science]
Bridges JR, Perry TJ (1987). Ceratocystiopsis ranaculosus sp. nov. associated with the southern pine beetle. Mycologia 79:630 –633.[CrossRef]
Buisman C (1932). Ceratostomella ulmi, de geslachtelijke vorm van Graphium ulmi Schwartz. Tijdschrift over Plantenziekten 38:1 –5.
Butin H (1968). A new species of Ceratocystis causing blue-stain in Araucaria araucana. Canadian Journal of Botany 46:61 –63.
Butin H, Aquilar AM (1984). Blue-stain fungi on Nothofagus from Chile - including new species of Ceratocystis Ellis & Halst. Phytopathologische Zeitschrift 109:80 –89.
Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN
(2002). A preliminary overview of the Diaporthales based
on large subunit nuclear ribosomal DNA sequences.
Mycologia 94:1017
–1031.
Crane JL, Schoknecht JD (1973). Conidiogenesis in Ceratocystis ulmi, Ceratocystis piceae and Graphium penicillioides. American Journal of Botany 60:346 –354.[CrossRef]
Davidson RW (1935). Fungi causing stain in logs and lumber in the Southern States, including five new species. Journal of Agricultural Research 50:789 –807.
Davidson RW (1942). Some additional species of Ceratostomella in the United States. Mycologia 34:650 –662.[CrossRef]
Davidson RW (1955). Wood-staining fungi associated with bark beetles in Engelmann spruce in Colorado. Mycologia 47:58 –67.[Medline]
Davidson RW (1958). Additional species of Ophiostomataceae from Colorado. Mycologia 50:661 –670.[CrossRef]
Davidson RW (1966). New species of Ceratocystis from conifers. Mycopathologia et Mycologia applicata 28:273 –286.[CrossRef]
Davidson RW (1971). New species of Ceratocystis.Mycologia 63:5 –15.[CrossRef]
De Beer ZW, Harrington TC, Vismer HF, Wingfield BD, Wingfield MJ
(2003). Phylogeny of the Ophiostoma stenoceras –
Sporothrix schenckii complex. Mycologia
95:434
–441.
De Hoog GS (1974). The genera Blastobotrys, Sporothrix, Calcarisporium and Calcarisporiella gen. nov. Studies in Mycology 7:1 –84.[Medline]
De Hoog GS (1993). Sporothrix-like anamorphs of Ophiostoma species and other fungi. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity (Wingfield MJ, Seifert KA, Webber J, eds). American Phytopathological Society, St. Paul, Minnesota: 53–60.
De Hoog GS, Scheffer RJ (1984). Ceratocystis versus Ophiostoma: a reappraisal. Mycologia 76:292 –299.[CrossRef]
Georgévitch P (1926). Ceratostomella querci n. sp. Comptes Rendus Hebdomadairs des Séances de l'Académie des Sciences 183:759 –761.
Glass NL, Donaldson GC (1995). Development of primer
sets designed for use with the PCR to amplify conserved genes from filamentous
Ascomycetes. Applied and Environmental Microbiology
61:1323
–1330.
Goidánich G (1935). Una nuova species di "Ophiostoma" vivente sul pero ed alcune osservazioni sull'esatta posizione sistematica della forma ascofora e delle forme metagenetiche del genere. Bollettino della Stazione di Patologia Vegetale di Roma 15:122 –168.
Goidánich G (1936). Il genere di Ascomiceti Grosmannia G. Goid. Bollettino della Stazione di Patologia Vegetale di Roma 16:26 –60.
Gorton C, Kim SH, Henricot B, Webber J, Breuil C (2004). Phylogenetic analysis of the bluestain fungus Ophiostoma minus based on partial ITS rDNA and beta-tubulin gene sequences. Mycological Research 108:759 –765.[CrossRef][Medline]
Griffin HD (1968). The genus Ceratocystis in Ontario. Canadian Journal of Botany 46:689 –718.
Gryzenhout M, Myburg H, Wingfield BD, Wingfield MJ (2006). Cryphonectriaceae (Diaporthales), a new family including Chrysoporthe, Cryphonectria, Endothia and allied genera. Mycologia: In Press.
Halsted BD (1890). Some fungous diseases of sweet potato. New Jersey Agricultural College Experiment Station Bulletin 76:1 –32.
Harrington TC (1981). Cycloheximide sensitivity as a taxonomic character in Ceratocystis. Mycologia 73:1123 –1129.[CrossRef]
Harrington TC (1987). New combinations in Ophiostoma of Ceratocystis species with Leptographium anamorphs. Mycotaxon 28:39 –43.
Harrington TC (1988). Leptographium species, their distributions, hosts and insect vectors. In: Leptographium root diseases of conifers (Harrington TC, Cobb FW, eds). APS Press, St. Paul, Minnesota: 1–39.
Harrington TC, McNew D, Steimel J, Hofstra D, Farrell R (2001). Phylogeny and taxonomy of the Ophiostoma piceae complex and the Dutch elm disease fungi. Mycologia 93:111 –136.[CrossRef]
Hausner G, Eyjólfsdóttir GG, Reid J (2003). Three new species of Ophiostoma and notes on Cornuvesica falcata. Canadian Journal of Botany 81:40 –48.[CrossRef]
Hausner G, Reid J (2003). Notes on Ceratocystis brunnea and some other Ophiostoma species based on partial ribosomal DNA sequence analysis. Canadian Journal of Botany 81:865 –876.
Hausner G, Reid J, Klassen GR (1992). Do galeate-ascospore members of the Cephaloascaceae, Endomycetaceae and Ophiostomataceae share a common phylogeny? Mycologia 84:870 –881.[CrossRef][Web of Science]
Hausner G, Reid J, Klassen GR (1993a). Ceratocystiopsis: a reappraisal based on molecular criteria. Mycological Research 97:625 –633.[CrossRef]
Hausner G, Reid J, Klassen GR (1993b). On the phylogeny of Ophiostoma, Ceratocystis s.s., and Microascus, and relationships within Ophiostoma based on partial ribosomal DNA sequences. Canadian Journal of Botany 71:1249 –1265.
Hausner G, Reid J, Klassen GR (1993c). On the subdivision of Ceratocystis s.l., based on partial ribosomal DNA sequences. Canadian Journal of Botany 71:52 –63.
Hausner G, Reid J, Klassen GR (2000). On the phylogeny of members of Ceratocystis s.s. and Ophiostoma that possess different anamorphic states, with emphasis on the anamorph genus Leptographium, based on partial ribosomal DNA sequences. Canadian Journal of Botany 78:903 –916.[CrossRef]
Hedgcock GG (1906). Studies upon some chromogenic fungi which discolor wood. Missouri Botanical Garden Annual Report 17:59 –114.[CrossRef]
Hsiau PT-W, Harrington TC (1997). Ceratocystiopsis brevicomi sp. nov., a mycangial fungus from Dendroctonus brevicomis (Coleoptera: Scolytidae). Mycologia 89:661 –669.[CrossRef]
Huelsenbeck JP, Ronquist F (2001). MRBAYES: Bayesian
inference of phylogenetic trees. Bioinformatics
17:754
–755.
Hunt J (1956). Taxonomy of the genus Ceratocystis.Lloydia 19:1 –58.[Medline]
Hutchison LJ, Reid J (1988). Taxonomy of some potential wood-staining fungi from New Zealand 1. Ophiostomataceae.New Zealand Journal of Botany 26:63 –81.
Jacobs K, Kirisits T (2003). Ophiostoma kryptum sp. nov. from Larix decidua and Picea abies in Europe, similar to O. minus. Mycological Research 107:1231 –1242.[CrossRef][Medline]
Jacobs K, Solheim H, Wingfield BD, Wingfield MJ (2005). Taxonomic re-evaluation of Leptographium lundbergii based on DNA sequence comparisons and morphology. Mycological Research 109:1149 –1161.[CrossRef][Medline]
Jacobs K, Wingfield BD, Wingfield MJ (2001). Phylogenetic relationships in Leptographium based on morphological and molecular characters. Canadian Journal of Botany 79:719 –732.[CrossRef]
Jacobs K, Wingfield MJ (2001). Leptographium species - Tree Pathogens, Insect Associates, and agents of blue-stain. The American Phytopathological Society, St. Paul, Minnesota.
Jacobs K, Wingfield MJ, Wingfield BD, Yamaoka Y (1998). Comparison of Ophiostoma huntii and O. europhioides and description of O. aenigmaticum sp. nov. Mycological Research 102:289 –294.[CrossRef]
Kim J-J, Kim SH, Lee S, Breuil C (2003). Distinguishing Ophiostoma ips and Ophiostoma montium, two bark beetle-associated sapstain fungi. FEMS Microbiology Letters 222:187 –192.[Medline]
Kim J-J, Lim YW, Seifert KA, Kim SH, Breuil C, Kim G-H (2005). Taxonomy of Ophiostoma radiaticola sp. nov. (Ophiostomatales, Ascomycetes), the teleomorph of Pesotum pini, isolates from logs of Pinus radiata.Mycotaxon 91:481 –496.
Kim J-J, Lim YW, Wingfield MJ, Breuil C, Kim GH (2004). Leptographium bistatum sp. nov., a new species with a Sporothrix synanamorph from Pinus radiata in Korea. Mycological Research 108:699 –706.[CrossRef][Medline]
Leach JG, Orr LW, Christensen C (1934). The interrelationships of bark beetles and blue-staining fungi in felled Norway pine timber. Journal of Agricultural Research 49:315 –341.
Lim YW, Alamouti S, Kim J-J, Lee S, Breuil C (2004). Multigene phylogenies of Ophiostoma clavigerum and closely related species from bark beetle-attacked Pinus in North America. FEMS Microbiology Letters 237:89 –96.[CrossRef][Medline]
Livingston WH, Davidson RW (1987). Ophiostoma subannulatum, a new fungal species pathogenic to grand fir roots. Mycologia 79:144 –147.[CrossRef]
Marais GJ, Wingfield MJ (1994). Fungi associated with infructescences of Protea species in South Africa, including a new species of Ophiostoma. Mycological Research 98:369 –374.
Marais GJ, Wingfield MJ (1997). Ophiostoma protearum sp. nov. associated with Protea caffra infructescences. Canadian Journal of Botany 75:362 –367.
Marais GJ, Wingfield MJ (2001). Ophiostoma africanum sp. nov., and a key to ophiostomatoid species from Protea infructescences. Mycological Research 105:240 –246.[CrossRef]
Marmolejo JG, Butin H (1990). New conifer-inhabiting species of Ophiostoma and Ceratocystiopsis (Ascomycetes, Microascales) from Mexico. Sydowia 42:193 –199.
Mathiesen-Käärik A (1960). Studies on the ecology, taxonomy and physiology of Swedish insect-associated blue stain fungi. Oikos 11:1 –25.[Medline]
Mathiesen A (1951). Einige neue Ophiostoma-Arten in Schweden. Svensk Botanisk Tidskrift 45:203 –232.
Melin E, Nannfeldt JA (1934). Researches into the blueing of ground wood-pulp. Svenska Skogsvårdsföreningens Tidskrift 32:397 –616.
Minter DW, Kirk PM, Sutton BC (1983). Thallic phialides. Transactions British Mycological Society 80:39 –66.
Moreau C (1952). Coexistence des formes Thielaviopsis et Graphium chez une souche de Ceratocystis major (van Beyma) nov. comb. Revue de Mycologie (Paris) 17:17 –25.
Mouton M, Wingfield MJ, Van Wyk PS (1992). The anamorph of Ophiostoma francke-grosmanniae is a Leptographium.Mycologia 84:857 –862.[CrossRef]
Mouton M, Wingfield MJ, Van Wyk PS (1994). Conidium development in anamorphs of Ceratocystis sensu lato: a review. South African Journal of Science 90:293 –298.
Münch E (1907). Die Blaufäule des Nadelholzes. I–II. Naturwissenschaftliche Zeitschrift für Forst-und Landwirtschaft 5:531 –573.
Nannfeldt JA (1932). Studien über die Morphologie und Systematik der nicht-lichenisierten inoperculaten Discomyceten. Nova Acta Regiae Societatis Scientiarum Upsaliensis, Series IV 8:1 –369.
Notredame C, Higgins DG, Heringa J (2000). T-coffee: a novel method for fast and accurate multiple sequence alignment. Journal of Molecular Biology 302:205 –217.[CrossRef][Web of Science][Medline]
O'Donnell K, Cigelnik E (1997). Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7:103 –116.[CrossRef][Web of Science][Medline]
Okada G, Seifert KA, Takematsu A, Yamaoka Y, Miyazaki S, Tubaki K (1998). A molecular phylogenetic reappraisal of the Graphium complex based on 18S rDNA sequences. Canadian Journal of Botany 76:1495 –1506.[CrossRef]
Olchowecki A, Reid J (1973). Taxonomy of the genus Ceratocystis in Manitoba. Canadian Journal of Botany 52:1675 –1711.
Parker AK (1957). Europhium, a new genus of the Ascomycetes with a Leptographium imperfect state. Canadian Journal of Botany 35:173 –179.[Medline]
Paulin-Mahady AE, Harrington TC, McNew D (2002).
Phylogenetic and taxonomic evaluation of Chalara, Chalaropsis, and
Thielaviopsis anamorphs associated with Ceratocystis.Mycologia 94:62
–72.
Posada D, Crandall KA (1998). MODELTEST: testing the
model of DNA substitution. Bioinformatics
14:817
–818.
Robak H (1932). Investigations regarding fungi on Norwegian ground wood pulp and fungal infection at wood pulp mills. Nyt Magazin for Naturvidenskaberne 71:185 –330.
Robinson-Jeffrey RC, Davidson RW (1968). Three new Europhium species with Verticicladiella imperfect states on blue-stained pine. Canadian Journal of Botany 46:1523 –1527.
Roets F, De Beer ZW, Dreyer LL, Crous PW, Zipfel R, Wingfield MJ
(2006). Multi-gene phylogeny of Ophiostoma spp.
associated with Protea infructescenses including two new species.
Studies in Mycology 55:199
–212.
Rumbold CT (1936). Three blue-staining fungi, including two new species, associated with bark beetles. Journal of Agricultural Research 52:419 –437.
Rumbold CT (1941). A blue stain fungus, Ceratostomella montium n. sp., and some yeasts associated with two species of Dendroctonus. Journal of Agricultural Research 62:589 –601.
Seifert KA, Wingfield MJ, Kendrick WB (1993). A nomenclator for described species of Ceratocystis, Ophiostoma, Ceratocystiopsis, Ceratostomella and Sphaeronaemella. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity (Wingfield MJ, Seifert KA, Webber J, eds). American Phytopathological Society, St. Paul, Minnesota, U.S.A.:269 –287.
Siemaszko W (1939). [Fungi associated with bark beetles in Poland.] [In Polish]. Planta Polonica 7:1 –54.
Six DL, Paine TD (1999). Allozyme diversity and gene flow in Ophiostoma clavigerum (Ophiostomatales: Ophiostomataceae), the mycangial fungus of the Jeffrey pine beetle, Dendroctonus jeffreyi (Coleoptera: Scolytidae). Canadian Journal of Forest Research 29:324 –331.[CrossRef]
Solheim H (1986). Species of Ophiostomataceae isolated from Picea abies infested by the bark beetle Ips typographus. Nordic Journal of Botany 6:199 –207.[CrossRef]
Spatafora JW, Blackwell M (1994). The polyphyletic origins of ophiostomatoid fungi. Mycological Research 98:1 –9.[CrossRef][Web of Science]
Swofford DL (2001). PAUP*. Phylogenetic analysis using parsimony (*and other methods), version 4.0b1. Sinauer Associates, Sunderland, Massachusetts.
Sydow H, Sydow P (1919). Mykologische Mitteilungen. Annales Mycologici 17:33 –47.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24:4876 –4882.
Upadhyay HP (1981). A monograph of Ceratocystis and Ceratocystiopsis. The University of Georgia Press, Athens, GA, U.S.A.
Upadhyay HP, Kendrick WB (1975). Prodromus for a revision of Ceratocystis (Microascales, Ascomycetes) and its conidial states. Mycologia 67:798 –805.[CrossRef]
Viljoen CD, Wingfield BD, Wingfield MJ (1999). Relatedness of Custingophora olivaceae to Gondwanamyces spp. from Protea spp. Mycological Research 103:497 –500.[CrossRef]
Viljoen CD, Wingfield MJ, Jacobs K, Wingfield BD (2000). Cornuvesica, a new genus to accommodate Ceratocystiopsis falcata. Mycological Research 104:365 –367.[CrossRef]
Von Arx JA (1952). Ueber die Ascomycetengattungen Ceratostomella Sacc., Ophiostoma Syd. und Rostrella Zimmerman. Antonie van Leeuwenhoek 18:13 –213.[CrossRef]
Von Arx JA (1974). The genera of fungi sporulating in pure culture. 2nd edition. J. Cramer, Lehre, Germany.
Von Arx JA, Müller E (1954). Die Gattungen der amerosporen Pyrenomyceten. Beiträge zur Kryptogamenflora der Schweiz 11:1 –134.
Von Arx JA, Van der Walt JP (1987). Ophiostomatales and Endomycetales. Studies in Mycology 30:167 –176.
Weijman ACM, De Hoog GS (1975). On the subdivision of the genus Ceratocystis. Antonie van Leeuwenhoek 41:353 –360.[CrossRef][Medline]
Wingfield BD, Grant WS, Wolfaardt JF, Wingfield MJ (1994). Ribosomal RNA sequence phylogeny is not congruent with ascospore morphology among species in Ceratocystis sensu stricto.Molecular Biology and Evolution 11:376 –383.[Abstract]
Wingfield MJ (1993). Problems in delineating the genus Ceratocystiopsis. In: Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity (Wingfield MJ, Seifert KA, Webber J, eds). American Phytopathological Society, St. Paul, Minnesota:21 –26.
Wingfield MJ, Seifert KA, Webber J (1993). Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity. American Phytopathological Society, St. Paul, Minnesota.
Wright EF, Cain RF (1961). New species of the genus Ceratocystis. Canadian Journal of Botany 39:1215 –1230.[Medline]
Yamaoka Y, Wingfield MJ, Takahashi I, Solheim H (1997). Ophiostomatoid fungi associated with the spruce bark beetle Ips typographus f. japonicus in Japan. Mycological Research 101:1215 –1227.[CrossRef]
Zhou XD, De Beer ZW, Cibrian D, Wingfield BD, Wingfield MJ (2004a). Characterization of Ophiostoma species associated with pine bark beetles from Mexico, including O. pulvinisporum sp. nov. Mycological Research 108:690 –698.[CrossRef][Medline]
Zhou XD, De Beer ZW, Harrington TC, McNew D, Kirisits T, Wingfield
MJ (2004b). Epitypification of Ophiostoma galeiforme and
phylogeny of species in the O. galeiforme complex.
Mycologia 96:1306
–1315.
This article has been cited by other articles:
|
|
 |
|
  M. Bommer, M.-L. Hutter, S. Stilgenbauer, G. S. de Hoog, Z. W. de Beer, and N. Wellinghausen Fatal Ophiostoma piceae infection in a patient with acute lymphoblastic leukaemia J. Med. Microbiol., March 1, 2009; 58(3): 381 - 385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Roets, Z. W. de Beer, M. J. Wingfield, P. W. Crous, and L. L. Dreyer Ophiostoma gemellus and Sporothrix variecibatus from mites infesting Protea infructescences in South Africa Mycologia, May 1, 2008; 100(3): 496 - 510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Lu, C. Decock, X. Y. Zhang, and H. Maraite Leptographium sinoprocerum sp. nov., an undescribed species associated with Pinus tabuliformis-Dendroctonus valens in northern China Mycologia, March 1, 2008; 100(2): 275 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A Samson EDITORIAL AND REFLECTION Stud Mycol, January 1, 2007; 57(1): 1 - 3. [Full Text] [PDF]
|
|
|
|
|
|
M. Arzanlou, J.Z. Groenewald, W. Gams, U. Braun, H.-D Shin, and P.W. Crous Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera Stud Mycol, January 1, 2007; 58(1): 57 - 93. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Roets, Z. W. de Beer, L. L. Dreyer, R. Zipfel, P. W. Crous, and M. J. Wingfield Multi-gene phylogeny for Ophiostoma spp. reveals two new species from Protea infructescences. Stud Mycol, January 1, 2006; 55: 199 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. W. Crous, B. Slippers, M. J. Wingfield, J. Rheeder, W. F.O. Marasas, A. J.L. Philips, A. Alves, T. Burgess, P. Barber, and J. Z. Groenewald Phylogenetic lineages in the Botryosphaeriaceae. Stud Mycol, January 1, 2006; 55: 235 - 253. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
