|
|
||||||||
1 Department of Genetics, Forestry and Agricultural Biotechnology Institute
(FABI), University of Pretoria, Pretoria, 0002, South Africa
2 Department of Microbiology and Plant Pathology, Forestry and Agricultural
Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South
Africa
3 Department of Microbiology, University of Stellenbosch, Private Bag X1,
Matieland, Stellenbosch, South Africa
*
Correspondence: Z. Wilhelm de Beer,
wilhelm.debeer{at}fabi.up.ac.za
| Abstract |
|---|
|
|
|---|
Taxonomic novelties: Ceratocystiopsis manitobensis (J. Reid & Hausner) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Cop. parva (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Cop. rollhanseniana (J. Reid, Eyjólfsd. & Hausner) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., Grosmannia abiocarpa (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. aenigmatica (K. Jacobs, M.J. Wingf. & Yamaoka) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. americana (K. Jacobs & M.J. Wingf.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. aurea (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. cainii (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. clavigera (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. crassivaginata (H.D. Griffin) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. cucullata (H. Solheim) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. davidsonii (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. dryocoetidis (W.B. Kendr. & Molnar) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. europhioides (E.F. Wright & Cain) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. francke-grosmanniae (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. galeiformis (B.K. Bakshi) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. grandifoliae (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. huntii (R.C. Rob.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. laricis (K. van der Westh., Yamaoka & M.J. Wingf.) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. leptographioides (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. olivacea (Math.-Käärik) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. pseudoeurophioides (Olchow. & J. Reid) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. radiaticola (J.-J. Kim, Seifert, & G.-H. Kim) Z.W. de Beer & M.J. Wingf. comb. nov., G. robusta (R.C. Rob. & R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. sagmatospora (E.F. Wright & Cain) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. vesca (R.W. Davidson) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov., G. wageneri (Goheen & F.W. Cobb) Zipfel, Z.W. de Beer & M.J. Wingf. comb. nov.
Keywords Ceratocystiopsis / Grosmannia / Ophiostoma / phylogenetics
| INTRODUCTION |
|---|
|
|
|---|
|
Teleomorph characters applied in taxonomic studies of Ophiostoma include the shape and size of the ascomata and ascospores, and the presence or absence of sheaths surrounding the ascospores. The majority of Ophiostoma spp. have ascomata with long necks giving rise to masses of sticky ascospores adapted for dispersal by insects (Upadhyay 1981, Harrington 1987, Jacobs & Wingfield 2001). In 1957, Parker described the genus Europhium A.K. Parker for a species that exhibits all the characters of Ophiostoma, but with ascocarps cleistothecial, lacking necks and ostioles (Parker 1957). Subsequently three additional species were described in Europhium (Robinson-Jeffrey & Davidson 1968). All four of the species were eventually transferred to Ophiostoma (Harrington 1987) because the formation or length of necks, and the presence of an ostiole, might be affected by the environment and were considered `less reliable' taxonomic characters (Upadhyay 1981). A number of phylogenetic studies confirmed that these species are closely related to Ophiostoma spp. with Leptographium anamorphs (Hausner et al. 2000, Lim et al. 2004).
Ophiostoma spp. have ascospores with unusual shapes. Several studies have applied this characteristic to define groups within the genus, which at the time of these studies was treated as a synonym of Ceratocystis (Wright & Cain 1961, Griffin 1968, Olchowecki & Reid 1973, Upadhyay 1981). For species that have falcate ascospores with sheaths and short perithecial necks, Upadhyay & Kendrick (1975) established Ceratocystiopsis H.P. Upadhyay & W.B. Kendr. However, Wingfield (1993) argued that ascospore shape should not be the sole character to delineate genera, and that it was illogical to maintain Ceratocystiopsis as a separate genus because Ophiostoma contained many species with a variety of other, distinct ascospore forms. He thus suggested that Ceratocystiopsis should be treated as a synonym of Ophiostoma and that ascospore morphology should only be one of several characteristics on which to base further subdivisions in the genus. Hausner et al. (1993a) proceeded to formally reduce Ceratocystiopsis to synonymy with Ophiostoma, based on partial SSU and LSU rDNA sequences. These authors included 10 Ceratocystiopsis spp., but only one Ophiostoma (O. ips (Rumbold) Nannf.) and one Ceratocystis (C. fimbriata Ellis & Halst.) species in the phylogenetic analysis of the data. Phylogenetic studies involving other ascomycete genera confirmed that ascospore morphology should not be used as the only character for taxonomic grouping as similar ascospore shapes often originated more than once in a genus (Hausner et al. 1992, Wingfield et al. 1994).
The diversity of the anamorphs associated with Ophiostoma established anamorph morphology as a preferred characteristic to group species in the genus (Münch 1907, Melin & Nannfeldt 1934, Hunt 1956, Davidson 1958, Mathiesen-Käärik 1960). However, this approach is complicated by the fact that a significant number of Ophiostoma spp. produce not only one, but combinations of up to three of the four possible anamorph states associated with the genus (De Hoog 1974, Okada et al. 1998). Ophiostoma ips, for example, has a continuum of synanamorph states, which based on current definitions range from Hyalorhinocladiella-like and Leptographium-like to Pesotum (Seifert et al. 1993). The anamorphs of just this one species have previously been classified in Graphium (Leach et al. 1934), Scopularia Preuss (Goidánich 1936), Cephalosporium auct. non Corda (Moreau 1952), Leptographium (Moreau 1952), Hyalorhinocladiella (Upadhyay 1981), Graphilbum H.P. Upadhyay & W.B. Kendr. (Upadhyay 1981), Acremonium Link: Fr. (Hutchison & Reid 1988), and Pesotum (Okada et al. 1998).
The only case where a teleomorph-genus has specifically been erected to accommodate Ophiostoma spp. based on a common anamorph, was when Goidánich (1936) established Grosmannia Goid. for four species with Leptographium anamorphs. He first described Grosmania invalidly, without a Latin description (Goidánich 1935). Later Goidánich validated the genus and at the same time corrected the spelling to Grosmannia (Goidánich 1936). Siemaszko (1939) reduced Grosmannia to synonymy with Ophiostoma on the basis of teleomorph morphology. Grosmannia has been treated in all subsequent studies as synonym of either Ophiostoma (Mathiesen 1951, Von Arx 1952, De Hoog 1974, Von Arx 1974, Seifert et al. 1993, Jacobs & Wingfield 2001) or Ceratocystis (Bakshi 1951, Moreau 1952, Hunt 1956, Davidson 1958, Griffin 1968, Upadhyay 1981). Phylogenetic studies have placed three of the original four Grosmannia species, G. serpens Goid., G. penicillata (Grosmann) Goid. and G. ips (Rumbold) Goid., in Ophiostoma (Hausner et al. 2000, Jacobs et al. 2001, Zhou et al. 2004a, 2005). The fourth species, G. pini (Münch) Goid., has been treated as a synonym of O. minus (Hedgc.) Syd. & P. Syd. (Moreau 1952, Hunt 1956, Griffin 1968, Olchowecki & Reid 1973, Upadhyay 1981) which, based on phylogeny, also resides in Ophiostoma (Gorton et al. 2004).
Amongst the four anamorph-genera associated with Ophiostoma spp., Sporothrix appears to be the most common form, with conidia produced sympodially on denticles arising from undifferentiated hyphae (De Hoog 1974). This is also the form that occurs most often as a synanamorph of Pesotum spp. (Crane & Schoknecht 1973, De Hoog 1974, Okada et al. 1998, Harrington et al. 2001). The original description of Pesotum included mononematous conidiophores and conidiogenous cells with prominent denticles, thus the Sporothrix-like component of the anamorph (Crane & Schoknecht 1973). In a study showing that Graphium is phylogenetically distinct from the synnematal anamorphs of Ophiostoma spp., and where Pesotum was redefined to encompass all synnematous anamorphs of Ophiostoma, only the synnematous form was described (Okada et al. 1998). The Sporothrix form was thus treated as a distinct synanamorph of Pesotum (Okada et al. 1998). However, Harrington et al. (2001) accepted the original description of Pesotum, which included the Sporothrix-like forms, but restricted the genus to anamorphs with affinities to the O. piceae complex. Harrington et al. (2001) also stated that the synnemata of Ophiostoma spp. outside the O. piceae complex are loose aggregates of Leptographium conidiophores, without the fused stipe cells that are characteristic of the O. piceae complex. These synnematous species outside the O. piceae complex often lack a Sporothrix anamorph, although some species produce a mononematous form without prominent denticles, resembling Hyalorhinocladiella. Hyalorhinocladiella was described for the mononematous anamorphs of Ceratocystiopsis and Ophiostoma (Upadhyay & Kendrick 1975), where conidia are produced through sympodial proliferation, leaving flat, ring-like scars on the surface of conidiogenous cells, as opposed to the denticles visible in Sporothrix spp. (Mouton et al. 1994, Benade et al. 1996). Although these anamorph-genera can be defined broadly, the delimitation of species groups based on anamorph morphology remains problematic, especially because of intermediate and overlapping forms.
Phylogenetic studies have substantially improved the ability to delimit species within almost all the morphological groups (based on ascospores and anamorphs) of the genus Ophiostoma (Harrington et al. 2001, De Beer et al. 2003, Jacobs & Kirisits 2003, Kim et al. 2003, Gorton et al. 2004, Lim et al. 2004, Zhou et al. 2004b). In the more recent of these studies, multigene approaches employing ribosomal together with protein-coding genetic data have become the norm. The morphological divergence in Ophiostoma strongly suggests that some of the morphological traits must be represented by monophyletic lineages. However, phylogenetic studies that have all been based on partial ribosomal DNA data have failed to support the definition of monophyletic lineages in Ophiostoma (Hausner et al. 1993b, 2000, Jacobs et al. 2001, Hausner & Reid 2003). In this investigation we reconsider the view that Ophiostoma might be logically subdivided based on monophyly. This is achieved using DNA sequences from domains 1 and 2 of the 5' end of the nuclear LSU gene, together with partial sequences for the β-tubulin gene region. Fifty species of Ophiostoma representing all the ascospore forms and anamorph shapes associated with the genus are included in the study.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
A large variety of potential outgroups were initially tested for suitability in the phylogenetic analysis used in this study. From these tests three species of Cryphonectria were selected as being the most appropriate and these include: Cry. cubensis (CBS 101281; LSU = AF408338 [GenBank] ; β-tubulin = DQ246580 [GenBank] ), Cry. havanensis (CBS 505.63; LSU = AF408339 [GenBank] ; β-tubulin = AY063478 [GenBank] ), and Cry. nitschkei (CBS 109776; LSU = AF408341 [GenBank] ; β-tubulin = DQ120768 [GenBank] ). The names used here are those published by Castlebury et al. (2002) in GenBank although we recognize that Gryzenhout et al. (2005) have shown that Cry. havanensis (CBS 505.63) is incorrectly identified and also represents Cry. cubensis.
DNA extraction and PCR
DNA was extracted from mycelium grown on 2 % MEA using the DNA extraction
method described by Aghayeva et al.
(2004). Two genes were
amplified for sequencing and phylogenetic analysis. The 5' end of the nuclear
large subunit rDNA was amplified using the primers LR0R (5' ACCCGCTGAACTTAAGC
3') and LR5 (5' TCCTGAGGGAAACTTCG 3')
(http://www.biology.duke.edu/fungi/mycolab/primers.htm).
Part of the β-tubulin gene was amplified with primers T10 (5'
ACGATAGGTTCACCTCCAGAGAC 3') (O'Donnell
& Cigelnik 1997) or Bt2a (5' GGTAACCAAATCGGTGC GCTTTC 3') in
combination with Bt2b (5' GGTAACCAAATCGGTGCTGCTTTC 3')
(Glass & Donaldson 1995).
Reaction volumes for the PCR amplification were 50 µL and contained 5 µL
10 x PCR reaction buffer (Super-Therm, JMR Holdings, U.S.A.), 2.5 mM
MgCl2, 10 mM dNTP, 10 µM of each primer, 2 µL DNA and 2.5 U
Super-Therm Taq polymerase (JMR Holdings, U.S.A.). The PCR conditions for the
amplification of both the LSU and β-tubulin genes included denaturing for
3 min at 94 °C, annealing at 47–52 °C for 1 min, and elongation
at 72 °C for 1 min. This was repeated for 35 cycles ending with a final
elongation step at 72 °C for 5 min. Success of the PCR amplification was
confirmed on a 1 % (w/v) agarose gel stained with ethidium bromide. DNA was
visualized under UV light. The PCR fragments were purified with QIAquick®
PCR purification kit (Quiagen®) eluting the DNA in water.
DNA sequencing
Sequencing of the purified PCR fragments was performed using the primers
noted above and the Big DyeTM Terminator v. 3.0 cycle sequencing premix
kit (Applied Biosystems, Foster City, CA, U.S.A.). The fragments were analyzed
on an ABI PRISIMTM 377 or ABI PRISIMTM 3100 Genetic Analyzer
(Applied Biosystems). DNA Sequence data were edited using Sequence Navigator
(Applied Biosystems) and aligned in CLUSTAL-X
(Thompson et al.
1997) and then in T-Coffee
(Notredame et al.
2000) using multiple alignment algorithms. T-Coffee was used to
combine the alignment results of Clustal X with the local and global pairwise
alignments obtained in T-Coffee, to produce a multiple sequence alignment with
the best agreement of these methods. The default parameters in T-Coffee were
used for the analysis. Manual adjustments of the dataset were performed in
PAUP v. 4.0b8 (Phylogenetic Analysis Using Parsimony)
(Swofford 2001) as follows:
for the analysis of the partial LSU gene, sequences were trimmed at the 5' and
3' ends to align with DNA sequences from GenBank used for the outgroups. For
the partial β-tubulin gene the sequences were trimmed on the 5' end to
correspond with the beginning of exon 4 of the β-tubulin gene. Analyses
were carried out using parsimony, neighbour-joining and maximum likelihood
(Swofford 2001) and Bayesian
inference (MrBayes 3.0b4) (Huelsenbeck
& Ronquist 2001).
Phylogenetic analysis
Maximum parsimony: For parsimony analysis, ambiguous and missing
nucleotides were eliminated and the remaining characters were weighted
according to the consistency index (CI). A heuristic search was performed with
tree-bisection-reconnection (TBR) branch swapping. The resulting trees were
used to obtain a majority rule consensus tree. Confidence values were
estimated using Bootstrap analysis (1000 replicates) with the full consensus
option.
Bayesian inference: Data were analysed using a Bayesian approach based on a Markov chain Monte Carlo (MCMC) analysis. A general time reversal (GTR+I+G) model as determined by AIC criteria of Modeltest (Posada & Crandall 1998) was used for the analysis. The proportion of sites was assumed to be invariable, while the rate of the remaining sites was drawn from a gamma distribution with six categories. All parameters were inferred from the data. Four Markov chains were initiated at random and the program was allowed to run for 2000000 generations with a sample frequency of 100. The analysis was repeated six times and consensus trees obtained from the six independent analyses were examined for consistency. One of the six analyses was used to calculate a consensus tree with mean branch lengths. The likelihood convergence was determined and these sampled trees were discarded as burn in. The following trees with their branch lengths were used to generate a consensus tree based on 50 % majority rule with mean branch lengths and posterior probabilities for the nodes using PAUP (Swofford 2001).
Neighbour-joining: A distance tree was calculated using Neighbour-joining analysis based on the evolutionary model that was determined as GTR+I+G based on AIC criteria using the Modeltest 3.06 (Posada & Crandall 1998). Distance settings were adjusted according to the Akaike information criteria (AIC) model: proportion invariable sites were assumed to be 0.4369 and the rates for variable sites were assumed to follow a gamma distribution with shape parameter of 0.5593. Confidence was determined by 1000 bootstrap replicates. The starting tree was obtained from the Neighbour-joining tree, the branch swap algorithm set to TBR (tree bisection reconnection).
Maximum likelihood: Likelihood settings were set according to GTR+I+G model as determined by AIC criteria in Modeltest 3.06 (Posada & Crandall 1998). Assumed proportion invariable sites were set to 0.4369. The variable sites were assumed to have a gamma distribution with a 0.5593 shape parameter. The search was performed heuristically with random stepwise addition and TBR branch swapping. Confidence values were estimated using bootstrap analysis (1000 replicates) determined by heuristic search and TBR branch swapping.
| RESULTS |
|---|
|
|
|---|
|
Phylogenetic analysis
Preliminary cladistic analysis based on parsimony showed that trees
generated for both LSU (data not shown) and combined LSU/β-tubulin gene
regions had similar topologies. Furthermore, the combined data set resulted in
higher confidence values for the obtained groupings. Combined LSU and
β-tubulin data sets (excluding β-tubulin introns), which consisted
of a total of 934 characters, were thus used. Congruence of the LSU and
β-tubulin datasets was not supported by the partition homogeneity test
(PHT). This was most probably due to the highly conserved nature of the
β-tubulin gene resulting in poor resolution of the terminal branches. The
similar node topology of the trees obtained from the LSU and
LSU/β-tubulin genes, and the increased bootstrap support for the groups
obtained using the combined data set, justified that the data of these two
genes should be considered together, irrespective of the incongruence of the
loci.
Maximum parsimony: For the cladistic analysis of the combined data set, 39 missing and ambiguous characters were excluded from the analysis. Of the remaining 895 characters, 608 characters were constant, 48 variable characters were parsimony-uninformative and 239 characters were parsimony-informative. Characters were re-weighted according to the maximum consistency index. This resulted in 751 characters with a weight of 1, and 144 characters with a weight other than 1. Four trees with similar topologies were obtained using maximum parsimony analysis with the tree bisection reconnection (TBR) branch swapping algorithm. The deeper nodes were consistent in all four trees, with slight variations in the topology of the terminal nodes. From the four trees a 50 % majority rule consensus tree was compiled with the TBR algorithm. The tree length was 383 steps, CI = 0.656, and the retention index (RI) = 0.860. A consensus cladogram was obtained (Fig. 1).
The cladogram (Fig. 1) showed that the taxa are grouped in distinct, well-supported clades. Clade A (91 % bootstrap) included only taxa that have Leptographuim anamorph states. All the species in this group had intron 4 and lacked intron 5 in the β-tubulin gene (Fig. 1). Clade B (82 % bootstrap) consisted of several distinct groups. Within Clade B, Clade C (100 % bootstrap) formed a monophyletic group including the recently described species O. rollhansenianum J. Reid, Eyjólfsd. & Hausner and O. manitobense J. Reid & Hausner, as well as taxa previously residing in the genus Ceratocystiopsis. These taxa all have short perithecial necks and falcate ascospores, and are sensitive to cycloheximide. Two anamorph states are associated with taxa in this group. They are Sporothrix, the anamorph of O. ranaculosum (J.R. Bridges & T.J. Perry) Hausner, J. Reid & Klassen, and Hyalorhinocladiella, associated with O. minuta-bicolor (R.W. Davidson) Hausner, J. Reid & Klassen, O. minutum Siemaszko, O. minimum (Olchowecki & J. Reid) Hausner, J. Reid & Klassen, O. rollhansenianum and O. manitobense.
|
Clade H (76 % bootstrap) consisted only of taxa with Sporothrix anamorphs and ascospores varying from orange section to allantoid in shape. The species in this clade all lacked intron 4 and had intron 5 in the β-tubulin gene (Fig. 1). In this clade, O. nigrocarpum (R.W. Davidson) de Hoog grouped separately from the other taxa that formed a clade with 98 % bootstrap support. Species in this clade include Sporothrix schenckii Hektoen & C.F. Perkins, the type species for the anamorph-genus Sporothrix, O. stenoceras (Robak) Nannf., S. inflata de Hoog, O. fusiforme D.N. Aghayeva & M.J. Wingf. and O. lunatum D.N. Aghayeva & M.J. Wingf. The three species of Ophiostoma found within infructescences of Protea spp. in South Africa, O. splendens G.J. Marias & M.J. Wingf., O. protearum G.J. Marias & M.J. Wingf., and O. africanum G.J. Marias & M.J. Wingf., constituted a well-defined, smaller clade with strong bootstrap support within Clade H.
Bayesian inference: Consistent results were obtained in the six runs of the Bayesian phylogenetic analysis (Model GTR+I+G). The topologies of the obtained trees differed only slightly in the terminal nodes where low confidence values were obtained. No variations were observed in the deeper nodes supported by high confidence values. The stationary phase of the Markov chains was observed after 33000 generations. The first 2000 trees (representing 200000 generations) were thus discarded and 18000 trees were included to calculate the 50 % rule consensus tree for each run. One of the phylogenetic trees obtained is presented in Fig. 2. The calculated confidence values (posterior probabilities) are indicated above the relevant nodes where support exceeded 50 %.
The deeper nodes obtained from the Bayesian analysis (MB) were identical to those obtained with maximum parsimony (MP). Support for the groups was, however, higher for Bayesian inference in the deeper branches than the Bootstrap support obtained for MP: group A (MB = 99 %; MP = 91 %), group B (MB = 86 %; MP = 82 %), group C (MB = 100 %; MP = 100 %), group D (MB = 100 %; MP = 66 %). Group D consisted of several subgroups. Groups E (MB = 100 %; MP = 100 %), H (MB = 98 %; MP = 76 %), and J (MB = 100 %; MP = 98 %) remain clustered together with high statistical support. However, the topology of the groups found within group D, obtained from Bayesian inference, differ in structure from the topology obtained in MP analysis. One major difference in topology is that group E forms as a separate group basal to group H and G in the MP analysis, while Bayesian inference resulted in group E forming part of group G. However, group E remained a separate entity with high posterior probability support.
Neighbour-joining: Phylogenetic distance was determined by Neighbour-joining (NJ) analyses based on the general time reversal model. Statistical support for the nodes was calculated using 1000 NJ bootstrap repeats. NJ support values for nodes obtained are indicated bold (Fig. 2). The topology obtained from NJ is similar to that obtained from Bayesian inference. With the exception of group E, clustering basal to group J and I closest to group G and not basal to groupings G and H or within group F as observed on MP and Bayesian analysis respectively.
Maximum likelihood: For the phylogenetic relationship estimated using maximum likelihood (ML), the GTR+I+G evolutionary model determined by Model Test based on Akaike Information Criteria (AIC) was applied. Estimated proportion invariable sites (I) was set to 0.4369 and the shape parameter for gamma distribution (G) was set to 0.5595 and no molecular clock was enforced on the data set. Bootstrap values for the groupings were determined by 1000 bootstrap repeats. ML support (50 % or higher) for groups obtained are indicated in italics (Fig. 2) on the phylogenetic tree obtained by Bayesian inference. Groups A–C, E, and H–J were supported by ML. However the deeper node resolution of these groups differs significantly from MP and Bayesian inference. Groupings D and G were not supported and group B had poor ML statistical support.
For consistency in the discussion we refer to the clades obtained in parsimony analysis, and the groups obtained in Bayesian, NJ and ML analysis, as groups.
| TAXONOMY |
|---|
|
|
|---|
Ophiostoma Syd. & P. Syd., Ann. Mycol. 17: 43. 1919. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascocarps subhyaline to dark brown to black, bases globose; necks straight or flexuous, cylindrical, brown to black; ostiole often surrounded by ostiolar hyphae. Asci 8-spored, evanescent, globose to broadly clavate. Ascospores hyaline, aseptate, cylindrical, lunate, allantoid, reniform, orange section- or pillow-shaped, sometimes with a hyaline, gelatinous sheath. Anamorphs most commonly Sporothrix and/or Pesotum, occasionaly Hyalorhinocladiella-like, rarely Leptographium-like. Phylogenetically classified in the Ophiostomatales.
Type species: Ophiostoma piliferum Fr.: Fr. Syd. & P. Syd., Ann. Mycol. 17: 43. 1919.
Basionym: Sphaeria pilifera Fr., Syst Mycol. 2: 472. 1822.
Ceratostoma piliferum (Fr.) Fuckel, Symb. Mycol. p. 128.
1869.
Ceratostomella pilifera (Fr.) G. Winter, Rabenh.
Kryptogamen-Flora 1: 252. 1887.
Linostoma piliferum (Fr.) Höhn., Ann. Mycol. 16: 91.
1918.
Ceratocystis pilifera (Fr.) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952. Anamorph: Sporothrix (De Hoog 1974).
Ceratocystiopsis H.P. Upadhyay & W.B. Kendr., Mycologia 67: 799. 1975. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascocarps subhyaline to dark brown to black, bases globose to subglobose; necks relatively short, mostly tapered toward the apex, sometimes surrounded by a collar-like structure; ostiolar hyphae convergent or lacking. Asci 8-spored, evanescent, fusiform, clavate or ellipsoidal, hyaline. Ascospores hyaline, aseptate, elongate, falcate, or slender with obtuse ends, sometimes with bulbous swelling, most often with a hyaline sheath. Sensitive to cycloheximide. Anamorphs Hyalorhinocladiella or Sporothrix-like. Phylogenetically classified in the Ophiostomatales within a monopyletic lineage including Ceratocystiopsis minuta.
Ceratostomella minuta (Siemaszko) R.W. Davidson, Mycologia
34: 655. 1942.
Ceratocystis minuta (Siemaszko) J. Hunt, Lloydia 19: 49.
1956.
Ophiostoma concentricum (Olchow. & J. Reid) Hausner
& J. Reid, Canad. J. Bot. 81: 874. 2003.
Ophiostoma minimum (Olchow. & J. Reid) Hausner, J.
Reid & Klassen, Mycol. Res. 97: 631. 1993.
Ophiostoma minutum-bicolor (R.W. Davidson) Hausner, J.
Reid & Klassen, Mycol. Res. 97: 631. 1993.
Ophiostoma pallidobrunneum (Olchow. & J. Reid) Hausner
& J. Reid, Canad. J. Bot. 81: 875. 2003.
Ophiostoma parvum (Olchow. & J. Reid) Hausner, J. Reid
& Klassen, Mycol. Res. 97: 631. 1993.
Ophiostoma ranaculosum (J.R. Bridges & T.J. Perry)
Hausner, J. Reid & Klassen, Mycol. Res. 97: 631. 1993.
Status of other species linked to Ceratocystiopsis
Ceratocystiopsis crenulata (Olchow. & J. Reid) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 124. 1981.
Ceratocystiopsis falcata (E.F. Wright & Cain) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 125. 1981.
Ceratocystiopsis longispora (Olchow. & J. Reid) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 128. 1981.
Ceratocystiopsis retusi (R.W. Davidson & T.E. Hinds)
H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 135. 1981. Grosmannia Goid., Boll. Staz. Patol. Veg. 16: 27. 1936. emend. Z.W. de Beer, Zipfel & M.J. Wingf.
Ascomata black, bases globose, seldom ornamented; necks absent or present, pigmented, tapered toward apex; ostiolar hyphae mostly absent, when present, convergent or divergent. Asci 8-spored, evanescent. Ascospores hyaline, aseptate, reniform, curved, allantoid, fusiform, orange section- or hat-shaped, often invested in a sheath. Anamorph Leptographium, or with synnemata appearing as a loose aggregation of Leptographium conidiophores. Phylogenetically classified in the Ophiostomatales within a monophyletic group containing Grosmannia penicillata. β-tubulin gene contains intron 4 and lacks intron 5.
Ophiostoma penicillatum (Grosmann) Siemaszko, Planta Pol.
7: 24. 1939.
Ceratocystis penicillata (Grosmann) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952.
Scopularia penicillata (Grosmann) Goid., Boll. Staz.
Patol. Veg. 16: 39. 1936.
Verticicladiella penicillata (Grosmann) W.B. Kendr.,
Canad. J. Bot. 40: 776. 1962.
Ophiostoma abiocarpum (R.W. Davidson) T.C. Harr.,
Mycotaxon 28: 41. 1987.
Ceratocystis aurea (R.C. Rob.-Jeffr. & R.W. Davidson)
H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 37. 1981.
Ophiostoma aureum (R.C. Rob.-Jeffr. & R.W. Davidson)
T.C. Harr., Mycotaxon 28: 41. 1987.
Ophiostoma cainii (Olchow. & J. Reid) T.C. Harr.,
Mycotaxon 28: 41. 1987.
Ceratocystis clavigera (R.C. Rob.-Jeffr. & R.W.
Davidson) H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 40. 1981.
Ophiostoma clavigerum (R.C. Rob.-Jeffr. & R.W.
Davidson) T.C. Harr., Mycotaxon 28: 41. 1987.
Graphiocladiella clavigera H.P. Upadhyay, In Upadhyay,
Monograph of Ceratocystis and Ceratocystiopsis: 40. 1981.
Pesotum clavigerum (H.P. Upadhyay) G. Okada & Seifert,
Canad. J. Bot. 76: 1503. 1998.
Ceratocystiopsis crassivaginata (H.D. Griffin) H.P.
Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 123. 1981.
Ophiostoma crassivaginatum (H.D. Griffin) T.C. Harr.,
Mycotaxon 28: 41. 1987.
Ophiostoma davidsonii (Olchow. & J. Reid) H. Solheim,
Nordic J. Bot. 6: 203. 1986.
Ophiostoma dryocoetidis (W.B. Kendr. & Molnar) de Hoog
& R.J. Scheff., Mycologia 76: 297. 1984.
Verticicladiella dryocoetidis W.B. Kendr. & Molnar,
Canad. J. Bot. 43: 39. 1965.
Ophiostoma europhioides (E.F. Wright & Cain) H.
Solheim, Nordic J. Bot. 6: 203. 1986.
Ophiostoma francke-grosmanniae (R.W. Davidson) de Hoog
& R.J. Scheff., Mycologia 76: 297. 1984.
Ophiostoma galeiforme (B.K. Bakshi)
Math.-Käärik, Medd. Skogsforskninginst. 43: 47. 1953.
Ophiostoma grandifoliae (R.W. Davidson) T.C. Harr.,
Mycotaxon 28: 41. 1987.
Ophiostoma huntii (R.C. Rob.-Jeffr.) de Hoog & R.J.
Scheff., Mycologia 76: 297. 1984.
Ophiostoma leptographioides (R.W. Davidson) Arx, Antonie
van Leeuwenhoek 18: 211. 1952.
Ceratocystis leptographioides (R.W. Davidson) J. Hunt,
Lloydia 19: 28. 1956.
Ceratocystis olivacea (Mathiesen) J. Hunt, Lloydia 19: 29.
1956.
Ophiostoma piceiperdum (Rumbold) Arx, Antonie van
Leeuwenhoek 18: 211. 1952.
Ceratocystis piceiperdum (Rumbold) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952.
Ophiostoma pseudoeurophioides (Olchow. & J. Reid)
Hausner, J. Reid & Klassen, Canad. J. Bot. 71: 1264. 1993.
Hyalopesotum pini L.J. Hutchison & J. Reid, N.Z. J.
Bot. 26: 90. 1988.
Ceratocystis robusta (R.C. Rob.-Jeffr. & R.W.
Davidson) H.P. Upadhyay, In Upadhyay, Monograph of Ceratocystis and
Ceratocystiopsis: 58. 1981.
Ophiostoma robustum (R.C. Rob.-Jeffr. & R.W. Davidson)
T.C. Harr., Mycotaxon 28: 42. 1987.
Ophiostoma sagmatosporum (E.F. Wright & Cain) H.
Solheim, Nordic J. Bot. 6: 203. 1986.
Phialographium sagmatosporae H.P. Upadhyay & W.B.
Kendr., Mycologia 66: 183. 1974.
Graphium sagmatosporae (H.P. Upadhyay & W.B. Kendr.)
M.J. Wingf. & W.B. Kendr., Mycol. Res. 95: 1332. 1991.
Ophiostoma serpens (Goid.) Arx, Antonie van Leeuwenhoek
18: 211. 1952.
Ceratocystis serpens (Goid.) C. Moreau, Rev. Mycol.
(Paris), Suppl. Colon. 17: 22. 1952.
Scopularia serpens Goid., Boll. Staz. Patol. Veg. 16: 42.
1936.
Verticicladiella serpens (Goid.) W.B. Kendr., Canad. J.
Bot. 40: 781. 1962.
Leptographium alacre (M.J. Wingf. & Marasas) M.
Morelet, Ann. Soc. Sci. Nat. Archéol. Toulon Var 40: 44. 1988.
Ophiostoma vescum (R.W. Davidson) Hausner, J. Reid &
Klassen. Can J. Bot. 71: 1264. 1993.
Ophiostoma wageneri (Goheen & F.W. Cobb) T.C. Harr.,
Mycotaxon 28: 42. 1987.
Verticicladiella wageneri var. ponderosae T.C.
Harr. & F.W. Cobb, Mycol. 78: 568. 1986.
Status of other species linked to Leptographium